The program Piano is developed for predicting piRNAs. This algorithm uses piRNA-transposon interaction information. Support vector machine (SVM) is applied on these features. Transposon sequences are required. The SVM classifier can be used in a wide range of species including human, mouse, rat, fruit fly and insect pests.

Download and unpack the Piano folder to a desired location on your computer. We provide Piano as executable (.sh) file that runs on Linux system. Before the prediction please make sure your computer has installed these third-party software, which including Seqmap, RNAplex and LIBSVM (PERL version).

Seqmap (http://www-personal.umich.edu/~jianghui/seqmap/)
RNAplex (http://www.bioinf.uni-leipzig.de/~htafer/RNAplex/RNAplex.html)
LIBSVM (http://www.csie.ntu.edu.tw/~cjlin/libsvm/index.html)

Piano can predict piRNA from small RNA data, which needs corresponding specie’s transposon sequences, all these sequences should in FASTA format and ensure there is no any blank space in the sequence’s ID. The predicted piRNA will be saved in Predicted_piRNA.txt.

The format of your input sequence should be like this:
>t0000001_435008
TGGAATGTAAAGAAGTATGGAG
>t0000002_262222
TGGAATGTAAAGAAGTATGG
>t0000003_134962
TGGAATGTAAAGAAGTATGGA

>csug10_LTR/Gypsy_+_2381_2433
TATGTATCTATGTATGTGTATGTATATCTATATATATTATAAATATTTATAT
>csug1000_SINE_+_3941_4060
ATCTGTACTAATATTGTAAATTTGTTTGTTGGGAGAAATCTCTGGAACTACTGAACCAATGTTG
>csug100001_DNA/TcMar_C_6517_6596
CTCTAGCTCTATCTGTATGTATATATATTTATATATGTGTTTACAATATATACGTGTATGTAAATATAC

Please contact me for any question.